eXtension collects fact-based information from subject matter experts in extension offices at from 74 land-grant institutions in the US so it can be easily accessed by anyone 24/7/365. This non-profit is overseen by representatives of land grant institutions chosen by each of 7 regions in the US (details on mission and oversight can be found at the eXtension Foundation website).  

If you go to the website, it should auto-detect your location so you can find information from your closest extension office. You can also choose to select a different institution by zip code or state or just browse the list of institutions. Another option is to view subjects by resource areas aka Communities of Practice.

eXtension has a special search function that allows you to search almost 1000 cooperative extension sites. If you don’t find what you need there, you can Ask an Expert. You can even attach an image if your question is about something you’ve seen, like a plant disease or insect you can’t identify.

I just have to get on my soapbox for a moment. Unfortunately, despite its importance, funding for extension does not seem to be a priority. For example, last time I checked, the Iowa legislature was looking at a $20 million cut for extension, on top of state cuts for universities, on top of federal cuts for universities and extension. Similar or worse cuts are happening across the country.

If you find non-biased, independent information on agriculture to be a valuable service, please let your elected officials know. You could even use a nifty Web 2.0 service like Votizen!

To this:

When the scientific truth is more like this:

While we may write a lot about this topic, part of the battle for ideas is fought with pictures, and video too. I decided that we should put together a page of images for media to use. Here it is in its bare glory. So far, I thought that there could be four categories of pictures: Food, Science, Field, and Fun. The plan is to have several pre-edited sizes for each image, and full credits for those images. I want to make it easy for media to illustrate their stories.

So now the question is, how to depict genetic engineering? What kinds of pictures will be helpful? We have pictures such as the comparisons between GE and non-GE plants like the rotating images at the top of the blog. Have you seen anything you have liked, or might have some ideas for things to look for (or photoshop)? Let me know in the comments.

Not a maize geneticist or breeder? The resource might still be of use to you if you study another crop or if you are just interested in learning more about a particular plant gene and what it does.

Any feedback that you can provide would be a big help to the POPcorn team. POPcorn is funded by NSF.

Start at the POPcorn homepage: http://popcorn.maizegdb.org/ and try out the suggested tasks below. Feel free to come up with your own tasks to try out, too. Are they easy to do? Are you able to find the desired information? The gene sequence for waxy is provided below, but feel free to try any nucleotide or amino acid sequence of interest to you.

1. Are there any genetic stocks containing insertions or deletions in your DNA sequence.
2. Are there any gene models associated with your sequence? Is there more than one?
3. Is there evidence that your gene is expressed?
4. Is your DNA sequence of interest possibly duplicated within the maize genome?  (Try lowering your e-value)
5. Find your DNA sequence on the genome browsers. Is it possible to design PCR primers for your DNA sequence while you are within the browser. Try downloading your DNA sequence and its flanking sequence into a FASTA file.
6. Can you find the syntenic regions for your DNA sequence in rice and sorghum?

>lcl|AF267643 Zea mays starch synthase GBSSI (mwx) mRNA, partial cds
GTGTCGACGCCCGTGAAGGCCAAGGCGCTGAACAAGGAGGCGCTGCAGGCGGAGGTCGGGCTCCCGGTGGACCGGAACATCCCGGCCTGGGTGGCGTTCATCGGCAGGCTGGAAGAGCAGAAGGGACCCGACGTCATGGCGGCCGCCATCCCGCAGCTCATGGAGATGGTGGAGGACGTGCAGATCGTTCTGCTGGGCACGGGCAAGAAGAAGTTCGAGCGCATGCTCATGAGCGCCGAGGAGAAGTTCCCAGGCAAGGTGCGCGCCGTGGTCAAGTTCAACGCGGCGCTGGCGCACCACATCATGGCCGGCGCCGACGTGCTCGCCGTCACCAGCCGCTTCGAGCCCTGCGGCCTCATCCAGCTGCAGGGGATGCGATACGGAACGCCCTGCGCCTGCGCGTCCACCGGTGGACTCGTCGACACCATCATCGAAGGCAAGACCGGGTTCCACATGGGCCGCCTCAGCGTCGACTGCAACGTCGTGGAGCCGGCGGACGTCAAGAAGGTGGCCACCACCTTGCAGCGCGCCATCAAGGTGGTCGGCACGCCGGCGTACGAGGAGATGGTGAGGAACTGC

You can post any comments you have on POPcorn here and I’ll pass them along, or you can send Feedback directly to the POPcorn team. They send their thanks in advance for your much needed feedback!

Want to get updates about maize genetics resources? Become a fan of MaizeGDB on

This is intended to be an atlas of any and all peer-reviewed research related to the relative risks of plant genetic engineering in the context of plant breeding. David Tribe has maintained a list of 300 papers related to this topic on GMO Pundit, and earlier this year we decided that all this information needed to be more visible and accessible to everyone. After searching deep within the bowels of WordPress plugins and php code, I figured out how to use the WordPress platform to host and manage a separate set of custom pages that will store and organize details about each study in a way that people can easily browse and search to find what they want.

Check it out, play with the links and look at the example entries and you’ll see why I hardly posted anything on the blog in June or July! The Atlas currently only tells you how many studies have been entered, but when we have more to work with, I envision a page that will summarize the whole database with charts and graphs.

Anastasia has written a step by step guide on how to put together a GENERA entry. We have a list of about 300 studies to use as fodder for GENERA to begin with, and there are bound to be many more we don’t know about. You could perhaps start with our list of just the independent studies. Contributors can enter new studies by filling out a form on the inside end of the blog and submit it for the editors to review. Once approved, it will appear in the Atlas for everyone to see, and it will be crossed off the list as completed.

Eventually, we will add a guide on how to effectively use the Atlas, but first we need to populate it. And that’s where you come in. We really need the contributions of other scientists to help enter these many studies thoroughly and accurately, so that this resource can blossom forth and become an essential tool for everyone who wants to know what the sum total of the peer-reviewed scientific literature is.

Please help us spread the word and that we are looking for help from other scientists to summarize and enter studies into GENERA. We might also offer gifts to contributors, although we haven’t figured out how exactly that will work yet. We have prepared a press release, the full text of which is below, but you can view it as a PDF here. GENERA press release_final.pdf Pass it around!

Everyone I talk to about GENERA thinks it will be a really good resource. The world needs it, so let’s get to it!

FOR IMMEDIATE RELEASE

GENERA: Students Launch a New Public Resource on Genetic Engineering and Need your Help

One of the biggest challenges of accurately communicating scientific information about a controversial topic is making that information easily available and accessible to the public. In the area of genetic engineering in agriculture, the public perception is that it lacks independent research on the risks, yet the scientific literature is replete with studies addressing those very questions. A small group of blogging scientists hopes to change that with a new web resource, but they need some help.

The plant genetics group blog, Biofortified, founded in 2008 by two graduate students, Karl Haro von Mogel and Anastasia Bodnar, hopes to bridge the gap. They have just launched a database called the GENetic Engineering Risk Atlas, or GENERA for short. Each entry in the atlas will include meta-information such as funding type, crop studied, where it was conducted, and the source of funding as well as an expert summary of the study itself. The database will be useful for consumers who wish to learn more, for NGOs and government regulatory organizations, and for scientists.

So far, Biofortified has a list of three hundred studies that need to be entered into the database. While more studies continue to be published on a regular basis, the first task is to get the current literature entered into GENERA. “With so many studies, it would take far too long for two people to catalogue them all,” said Bodnar. “We’ll need some help.”

“I programmed the background of GENERA to make it really easy to use,” said Haro von Mogel. “All it takes is filling out a simple form with the abstract, citation, crop, etc, and the atlas does the rest.” The scientist bloggers are counting on the success of community annotation projects and wiki-based resources to help populate the database.

Interested scientists can register for the blog at www.biofortified.org and contact its editors to be given access to create entries in the atlas. Anyone can make a simple entry, and scientists familiar with the language in the studies can also help out by writing a summary of the study. Several examples have already been entered into the atlas, with and without the optional summary.

In the future, GENERA will be useful for a variety of purposes. Studies can be searched on the basis of crop and study type, location, findings, funding, and publication status. Non-peer-reviewed studies will also eventually be included, and the site can be used to summarize all of the studies in the atlas. Scientists may find it useful in their own research. “We’re thinking about using it to write a review article someday,” said Bodnar.

“Getting this information more accessible to the public will be really beneficial for the public discussion of GE crops,” said Haro von Mogel. “People have this perception that there is no independent research done on these new traits, while about a third of the three hundred studies on our list are independently funded. People need to know about them.”

Haro von Mogel and Bodnar founded Biofortified in 2008 when they recognized the lack of science-based information about genetic engineering on the web and the have worked to create a place where scientists and non-scientists can discuss and learn from each other. The blog currently features posts written by other graduate students and professors in the field.

Biofortified is independently run on a volunteer basis, and is not supported by any funding from any companies or government entities. While site hosting costs were initially footed by the founding members, these costs are now covered by a Changemakers grant awarded to Biofortified for winning the Ashoka Changemakers GMO Risk or Rescue contest. (http://www.biofortified.org/2009/11/we-won/)

Links:

The GENERA homepage:

http://www.biofortified.org/genera/

GENERA Tutorial:

http://www.biofortified.org/genera/genera-tutorial/

An example entry with a summary of the study:

http://www.biofortified.org/genera/entries/long-term-cow-feeding-study-with-bt-corn/

An example entry without a summary:

http://www.biofortified.org/genera/entries/maize-gene-expression-and-nitrogen-fertilization/

For more information about Biofortified:

http://www.biofortified.org/about/

Contact:

Email contact (AT) biofortified [DOT] org

One resource that I often refer back to is a 3 part series on plant patents by Clark Wolf, professor of philosophy at Iowa State University: Plants, Patents, Property, and Pirates. He also has an article on gene patents. As a bioethicist, Clark provides good insight into the issue of patenting life. In addition to these, all of the Bioethics in Brief articles are quite interesting.

• Part I:  Luther Burbank versus Thomas Jefferson
• Part II:  Theft by Patent?
• Part III:  Piracy or Technology Transfer?
• Patents on Breast Cancer Genes: BRCA-1 and BRCA-2

Another great resource (and one that’s a little more recent) is by Joe Miller, professor of law at Lewis and Clark Law School. His expertise lies in intellectual property, and that’s what his three part series, hosted at Cooking Up a Story, focuses on.

• Patent Law: How Patents Grew Over Time To Include Living Organisms
• Patent Law: How Patents Grew Over Time To Include Living Organisms – 2
• Patent Law: How Patents Grew Over Time To Include Living Organisms – 3

Do you know of any useful resources for understanding patents on organisms or genes or that question those patents? Share them in the comments.

Thanks to @hyperlocavore for posting about Joe Miller’s articles.

Bt effectively and selectively kills certain insects. Images from the Bacillus thuringiensis info page.

Bt, short for Bacillus thuringiensis, is a bacteria that produces a protein that kills certain types of insects. Different types of the gene that produces thais protein have been engineered into crops to make them resistant to those insects. The approach has been quite successful but the details can be confusing.

If you’re looking for science-based information on Bt crops, check out the Bacillus thuringiensis info page that was developed by Karen Chien of the University of California, San Diego, with the assistance of Raffi Aroian. The material is a little dated, but it’s still a great resource. I especially enjoy the cartoons!  :)

The Aroian lab studies the ways that “target pests develop resistance to Bacillus thuringiensis crystal proteins in order to protect this valuable natural resource.” They’re also studying how Bt could be used to treat parasites in animals and people, as in their recent article in PLoS: Bacillus thuringiensis Cry5B protein is highly efficacious as a single-dose therapy against an intestinal roundworm infection in mice (full text).

Thanks to Mica Veihman (@Mica_MON on Twitter) for reminding me about this great resource.

• Monsanto Co (MON.N) – Based in St. Louis, the company posted record net sales of $11.7 billion and net income of $2.1 billion for fiscal 2009. Among its key products are corn, soybeans and cotton that tolerate weed-killing treatments and resist pests.
• Pioneer Hi-Bred – Subsidiary of DuPont (DD.N) based in Johnston, Iowa. Produces, markets and sells hybrid seed in nearly 70 countries worldwide and is the closest rival to Monsanto for market share in U.S. biotech corn seed market. Revenue totaled $4 billion in 2008.
• Syngenta AG (SYNN.VX) – The Basel, Switzerland-based company operates in 90 countries and generated 2008 sales of $11.6 billion. Collaborating with International Rice Research Institute to improve rice.
• Dow AgroSciences – Subsidiary of Dow Chemical Co (DOW.N) based in Indianapolis, Indiana. With global sales of $4.5 billion, company offers insect-protected corn and cotton, among other seed products, and is expanding its research into wheat.
• BASF (BASF.DE) – Based in Ludwigshafen, Germany, this leading global chemical company is increasingly focusing its health and nutrition division on plant biotechnology to increase crop yields. Like its rivals, BASF is working on a drought-tolerant corn seed. Revenue in its agricultural division totaled 3.4 billion euros in 2008.
• Bayer CropScience AG – The unit of Bayer AG (BAYGn.DE), had 2008 sales of 6.4 billion euros and operates in 120 countries. The company is pursuing 56 “bioscience” research projects involving six crops.

Hopefully people will come to know that there is more to the private sector than just Monsanto. Lists of the big ones are easy to make, though, what about a profile of the little companies? Start-ups in Africa, South America? What about China?

This brings up another point. The perception is often that genetic engineering is a “corporate technology,” which is a nonsensical term. Technologies are not “corporate” or not, but they can be used by corporations, or not. Is Organic Ag a “corporate technology?” Corporations do use it, and market it. Biodynamic Agriculture is literally owned by Demeter, what does that make it?

Part of this perception that genetic engineering is a “corporate” thing, as opposed to a “democratic” thing is that most people know that private companies commercialize GE crops, even if they know know the name of Monsanto. However there are numerous government labs and agencies, university research labs and groups, and non-profit organizations that also do research on genetic engineering, some of them have even developed and released (or will soon release) GE cultivars. For example, Papaya’s resistant to the Ringspot Virus were developed by the University of Hawaii and Cornell among others. The Donald Danforth Plant Science Center in St. Louis is working on cassava breeding and engineering for protein, mineral, and pro-Vitamin A content as well as disease resistance and resistance to post-harvest degradation and reduced cyanide poisoning for African countries. The BioCassava Plus project is part of the HarvestPlus program, which includes many other similar projects such as Golden Rice.

What are some others?

I imagine that not every academic lab wants to cry out “Hey we’re making GMOs!” when their research can be a target for vandalism. When I came to UC Davis in the fall of 1999, some fields and a field building were destroyed as a protest against genetic engineering – which destroyed no GE plants, just a grad student’s years of work. The same year, a research building in Michigan was burnt to the ground, and members of the Earth Liberation Front were caught and sentenced just last year. (While I worked in one academic lab some years later that was studying drought tolerance in tomatoes, a broken window pane in the greenhouse was cause for brief alarm while we made sure that no one broke in.)

Although the research environment in the US is a lot more calm today than at the turn of the milennium, and few cases of vandalism happen here (unlike, say, Germany or the UK), there is probably still reluctance on the part of academic labs to broadcast their work related to genetic engineering outside the scientific literature.

I once covered a protest that happened at UC Davis over the Dendrome Project, (article available here) a mere database of tree genome research, so you can see that even the suggestion of what might be going on in university labs can spark angry responses.

Nevertheless, there are many publicly-funded labs in the US and beyond that are doing work on genetic engineering, from making virus-resistant grapes to phytoremediation at UC Berkeley, and the public doesn’t really know about them. What public labs or research programs do you know about that are doing work on genetic engineering, from basic science to applied?

Any smaller companies working on GE crops? I know of one, Mendel Biotechnology, which has been mentioned here before. Then there’s Ventria Bioscience as well.

Let’s make a list so that maybe we could help people understand the full scope of who works in this field, and what they work on.

Reuters asks Is Monsanto the answer or the problem? Maybe part of the problem is that the media isn’t doing much to help people hear about anything other than Monsanto’s latest stock prices? Let’s help them out.

For example, did you know that whole, uncut fruits and vegetables may be sold without any license and without charging sales tax? While growers of whole fruits and vegetables are not required to practice any particular food safety procedures, the Leopold Center recommends that Good Agricultural Practices (pdf) be used, such as using non-porus containers for transport of crops.

Of course, laws in Iowa could be different from other states, so make sure to check what is appropriate in your state (links for midwestern states can be found at the bottom of the page at “13. Can I sell my products in other states?”).

via the ISU Sus Ag mailing list.